Table 1: qPCR Primer Sequences.


Primer Forward (5' to 3') Reverse (5' to 3')

Car ATCTGCCGCTCTTCCGGTCC GGAACCCTGCATGGACTGCGT
Cyp2b10 TGCTGTCGTTGAGCCAACCTTCA GGGGCTCCCTGGGATTTCCG
Ugt1a1 TGTCTTTCAACTCAGACCGC AGATGCAGGGCTCAGAAGAT
Ugt1a6 AATTCAGATGCTGGCTGATG AAGTGTCTGAGCAGCAGGAA
Ugt1a9 ACTGCCTCCAGAAGAAGTCA CACAGGACCGTCTGAGGAA
Ugt2b5 GGCCAACCACCTTAGTTGAG TTCCATATCCTTAGGCAAGGGTT
Gsta1 CCCCTTTCCCTCTGCTGAAG TGCAGCTTCACTGAATCTTGAAAGC
Gsta2 CACACTCCTCTGGAGCTGGAT CCCGGGCATTGAAGTAGTGA
Sult1a1 CCCGTCTATGCCCGGATAC GGGCTGGTGTCTCTTTCAGAGT
Oatp1a1 CCAACGCAAGATCCAACAGAGTGTG TCGGGCCAACAATCTTCCCCAT
Oatp1a4 CGTGGGGATACCGAATTGTCT GCTTTTCCAAGATCAAGGCATTT
Mrp2 AGCAGGTGTTCGTTGTGTGT AGCCAAGTGCATAGGTAGAGAAT
Mrp3 CTGGGTCCCCTGCATCTAC GCCGTCTTGAGCCTGGATAAC
Mrp4 ACCCTCGTTGAAAGAC TGAAGCCGATTCTCCCTTC
Mrp6 TGTCTGCAAGCCATCGGACTGTTTG TGGAAAAGCGGTTCAGCAGGTTCC
Rpl13a CAAGAAAAAGCGGATGGTGG TCCGTAACCTCAAGATCT