Table 1: The primer sequence of the studied genes.


Beta actin Forward primer:5'–GGTCGGTGTGAACGGATTTGG -3 Reverse primer:5'- ATGTAGGCCATGAGGTCCACC-3

Alpha Synuclein Forward primer: 5'-CATTTGTCACTTGCTCTTTGG-3', Reverse primer: 5'-AATGCTGGACCAAACACAAA-3'